Skip to main content

Table 1 Primers used for PCR amplification and Sanger sequencing analyses

From: Rare MLL-ELL fusion transcripts in childhood acute myeloid leukemia—association with young age and myeloid sarcomas?

Name Sequence (5´– >3´) Direction Position/exon Reference sequence Gene
MLL-3735F CCCATCAGCAAGAGAGGATCCTGC Forward 3758-3781/7 NM_005933.3 MLL (KMT2A)
MLL-3878F AGTCAAGCAAGCAGGTCTCCCAGC Forward 3901-3924/7 NM_005933.3 MLL (KMT2A)
MLL-3947F1 GCCACCTACTACAGGACCGCCAAG Forward 3947-3970/7 NM_005933.3 MLL (KMT2A)
ELL-415R1 GGCACACACCGTGATCTTGTCCTG Reverse 438-415/4 NM_006532.3 ELL
ELL-498R1 TTGATGACAATGGCACTTCGGCTC Reverse 498-521/4 NM_006532.3 ELL
ELL-960R1 TCCAAGGAGGCTGCCAGTGCTC Reverse 981-960/7 NM_006532.3 ELL
ELL-1044R1 CGATGAAATCAGGAGGCTGCAGC Reverse 1066-1044/8 NM_006532.3 ELL
ABL1-91F1 CAGCGGCCAGTAGCATCTGACTTTG Forward 280-304/2 NM_005157.5 ABL1
ABL1-404R1 CTCAGCAGATACTCAGCGGCATTGC Reverse 617-593/3 NM_005157.5 ABL1