Skip to main content

Table 2 Primers used for PCR amplification and Sanger sequencing analyses

From: Novel GTF2IPDGFRB and IKZF1TYW1 fusions in pediatric leukemia with normal karyotype

Name Sequence (5′– > 3′) Position Reference sequence Gene
GTF2I-3306F1 AATCAGCTGAACCAAGCCAGTTG 3306–3328 NM_032999.3 GTF2I
PDGFRB-1732R1 TGTCAGGGTGGCTCTCACTTAGC 1732–1754 NM_002609.3 PDGFRB
GTF2I-3317F1 CCAAGCCAG TTGGAAGTTCCAGCCA 3317–3341 NM_032999.3 GTF2I
PDGFRB-1737R1 TCCCCACTGTCAGGGTGGCTCTCAC 1737–1761 NM_002609.3 PDGFRB
IKZF1-469F1 GAATGCTTGATGCCTCGGGAGA 469–490 NM_006060.6 IKZF1
TYW1-1282R1 CCGAGTGGCTCCCAATCAACTG 1282–1303 NM_018264.3 TYW1