Skip to main content

Table 1 Primers used in the real time PCR studies

From: The effect of caffeine on cisplatin-induced apoptosis of lung cancer cells

1. PUMA primers:  
PUMA forward primer: 5′-CTCGCTCTCGCTGGCGGAGCAG-3′
PUMA reverse primer: 5′-CGCTGCTGCTCTTGTCTC-3′
2. BAD primers:  
BAD forward primer: 5′-GACGCCAGTCACCAGCAGGAG-3′
BAD reverse primer: 5′-CGTCACTCATCCTCCGGAGCTC-3′
3. Bcl-XL primers:  
Bcl -XL forward primer: 5′-GGTGAGTCGGATCGCAGCTTG-3′
Bcl -XL forward primer: 5′-CTCTCGGCTGCTGCATTGTTC-3′
3. β-Actin Primers:  
β-Actin forward primer: 5′GTACGTTGCTATCCAGGCTGTG3′
β-Actin reverse primer: 5′CATGAGGTAGTCAGTCAGGTC-3′